α β γ δ ε ζ η θ ι κ λ μ ν ξ ο π ρ Σ σ τ υ φ χ ψ ω Δ Γ Ω Σ Λ Ψ Φ Ξ Θ Π °C Greckie litery

Central Collection of Strains (IBB)

Baza: Plazmidów
Nr w bazie: 760
Nazwa plazmidu: pMDU10
Gatunek: Escherichia coli K-12
Szczep: DJ125 (EC15814)
Genotyp: F-, supE44, hsdR17, thi-1, leuB6, lacY1, tonA21, recA56
Sekwencja plazmidu:
Konstrukcja: Replacement of BamHI - SapI fragment of pMDU3 plasmid encoding the 3' region of P1 dmt gene the equivalent fragment containing the 3' region of his-tagged dmt obtained by PCR amplification using pMDU3 DNA as a template, and primers: OMLO197 (5'GCGCAGCGGCGTTTTTGTTCC3') - OMLO305 (5'TAATAGGATCCTTAGTGGTGGTGGTGGTGGTGGAGCAATATACCCAAAACGTCATGAGCTACACC3')
Plasmid properties/Comments:
Mapa plazmidu:
Markery selekcyjne: amp
Stężenie antybiotyku:
Wielkość plazmidu: 7070 bp
Origin of replication/Incompatibility group: pMB1
Host range: E. coli
Inne elementy genetyczne:
Właściwości szczepu/komentarz:
Autor: Durawa M
Dostępność: non restricted
Patent:
Osoba deponująca: M. Durawa
Instytucja/wydział:
Data zdeponowania: 2004-11-23 12:21+01:00
Referencje: