| Baza: |
Plazmidów |
| Nr w bazie: |
102 |
| Nazwa plazmidu: |
pET21HCVhel |
| Gatunek: |
Escherichia coli |
| Szczep: |
DH5α |
| Genotyp: |
F-, f80dlacZDM15 Dlac(lac ZYA-argF)U169, deoR, hsdR17 (rk-,mk-), recA1, endA1, gyrA46, pho A, sup E44, thi-1, relA1 |
| Sekwencja plazmidu: |
|
| Konstrukcja: |
derivative of pET21a |
| Plasmid properties/Comments: |
|
| Mapa plazmidu: |
 |
| Markery selekcyjne: |
amp |
| Stężenie antybiotyku: |
|
| Wielkość plazmidu: |
6822 bp |
| Origin of replication/Incompatibility group: |
|
| Host range: |
E.coli |
| Inne elementy genetyczne: |
|
| Właściwości szczepu/komentarz: |
description of the sequence in the publication contains some mistakes – the insert is cloned in pET21a, not pET21b, using a different 5` primer then described in the publication (GGGGATCCGTGGACTTTATCCCT)! |
| Autor: |
Kim DW, Gwack Y, Han JH, Choe J. |
| Dostępność: |
restricted |
| Patent: |
|
| Osoba deponująca: |
Iwona Rosa |
| Instytucja/wydział: |
|
| Data zdeponowania: |
29.03.2002 |
| Referencje: |
Kim DW, Gwack Y, Han JH, Choe J. 1995 Biochem Biophys Res Commun 215:160-6. |