α β γ δ ε ζ η θ ι κ λ μ ν ξ ο π ρ Σ σ τ υ φ χ ψ ω Δ Γ Ω Σ Λ Ψ Φ Ξ Θ Π °C Greek letters

Central Collection of Strains (IBB)

Base: Plasmid collection
Number in base: 350
Plasmid name: M04C03
Species: E.coli
Strain: XLBlue
Genotype: XL1-Blue F`::Tn10 proA+B+ lacIq Δ(lacZ)M15/recA1 endA1 gyrA96(Nalr) thi hsdR17 (rK-mK+) glnV44 relA1 lac
Plasmid Sequence: chromosomal fragment of Paramecium, cloned into BamHI site in Bluescript IIKS-, flanked by sequence 5`- GATCGTTGTAAAACAGTTAGAGATAAATCCAGAAGAGTTCAATAAGATTA .. AAATATTATTTATATCCATTCGGGCATTTCATACTGCAATATTTAAGATC - 3`
Construction:
Plasmid properties/Comments:
Plasmid map:
Selectable Markers: amp
Antibiotic concetration:
Plasmid size: -
Origin of replication/Incompatibility group:
Host range:
Other genetic elements:
Strain properties/Comments:
Author: Keller AM, Cohen J.
Availability: restricted
Patent:
Depositor: R. Gromadka
Institution/Department:
Deposition date: 16.09.2002
References: Trends Genet. 2001 Jun. 17(6):306-308 Dessen P. i.in.; http://paramecium.cgm.cnrs-gif.fr