| Baza: |
Plazmidów |
| Nr w bazie: |
601 |
| Nazwa plazmidu: |
pMSK4 |
| Gatunek: |
Escherichia coli K12 |
| Szczep: |
UT5600 |
| Genotyp: |
leu proC trpE thiA rpsL Δ(fepA-ompT)
|
| Sekwencja plazmidu: |
available on request |
| Konstrukcja: |
Insertion of MluI-SalI fragment of pMSK3 plasmid, encoding the C-terminal moiety of His-tagged ParB protein of P1 plasmid prophage, in place of the corresponding MluI-SalI fragment of pBEF104. The nucleotide sequence between the termination codon of parB (TAA) and SalI site (GTCGAC) in this plasmid is the following: ACTTTCGCCATTCAAATTTCACTATTAACTGACTGTTTTTG |
| Plasmid properties/Comments: |
|
| Mapa plazmidu: |
 |
| Markery selekcyjne: |
amp |
| Stężenie antybiotyku: |
|
| Wielkość plazmidu: |
~3.0 kb |
| Origin of replication/Incompatibility group: |
pMB1 (pBR322)
|
| Host range: |
Escherichia coli |
| Inne elementy genetyczne: |
|
| Właściwości szczepu/komentarz: |
This plasmid is a derivative of pBR322 carrying the parB-(his)6 gene of P1 plasmid-prophage, under the control of promoter-operator region of trp operon of Serratia marcescens |
| Autor: |
Michal Skrzycki |
| Dostępność: |
restricted |
| Patent: |
|
| Osoba deponująca: |
Malgorzata Lobocka |
| Instytucja/wydział: |
|
| Data zdeponowania: |
2006-07-03 09:09+01:00 |
| Referencje: |
Michal Skrzycki (1999) Master' s Thesis, Department of Microbial Biochemistry, Institute of Biochemistry and Biophysics, PAS, Warsaw, Poland |