Baza: |
Plazmidów |
Nr w bazie: |
611 |
Nazwa plazmidu: |
pAJU8 |
Gatunek: |
Escherichia coli K12 |
Szczep: |
UT5600 |
Genotyp: |
leu proC trpE thiA rpsL Δ(fepA-ompT)
|
Sekwencja plazmidu: |
available on request |
Konstrukcja: |
Replacement of MunI-SalI fragment of pMSK4 (encoding the wild-type parB-[his]6) with MunI-SalI fragment obtained by PCR amplification of the relevant region of pMLO87mutB16 with one normal and one mutagenic primer to introduce (his)6 tag and SalI site at the end of parB16.
The nucleotide sequence between the termination codon of parB (TAA) and SalI site (GTCGAC) in this plasmid is the following: ACTTTCGCCATTCAAATTTCACTATTAACTGACTGTTTTTG
|
Plasmid properties/Comments: |
|
Mapa plazmidu: |
 |
Markery selekcyjne: |
amp |
Stężenie antybiotyku: |
|
Wielkość plazmidu: |
~5.5 kb |
Origin of replication/Incompatibility group: |
pMB1 (pBR322)
|
Host range: |
Escherichia coli |
Inne elementy genetyczne: |
|
Właściwości szczepu/komentarz: |
Derivative of pBR322 carrying transcriptional fusion of P1 parB16-(his)6 to the promoter-operator region of tryptophan operon of Serratia marcescens (trpPO). Served to overexpress mutant parB16-(his)6 for protein purification. |
Autor: |
Malgorzata Lobocka |
Dostępność: |
restricted |
Patent: |
|
Osoba deponująca: |
Malgorzata Lobocka |
Instytucja/wydział: |
|
Data zdeponowania: |
2006-07-03 09:09+01:00 |
Referencje: |
Adam Jujka (2001) Master's Thesis. IBB PAS. Warsaw; Łobocka and Yarmolinsky (1996) J. Mol. Biol. 259:366--382. |