Baza: |
Plazmidów |
Nr w bazie: |
624 |
Nazwa plazmidu: |
pMLO32 |
Gatunek: |
Escherichia coli K12 |
Szczep: |
DJ125 (=C600 recA) |
Genotyp: |
supE44 hsdR17 thr-1 leuB6 lacY1 thi-1 tonA21 recA
|
Sekwencja plazmidu: |
available on request |
Konstrukcja: |
Spontaneous mutant of pMLO6 (pGB2ts-parS+)(isolated as 6/1) stable in DJ125 lysogenized with lambda DKC296 (parA+parB+). Contains substitution of two T-s in the left arm of parS large palindrome by one C (the sequence of changed parS fragment is: AAAATCCAAGGTGAAAATCGCCAC)
|
Plasmid properties/Comments: |
|
Mapa plazmidu: |
 |
Markery selekcyjne: |
spc, str |
Stężenie antybiotyku: |
|
Wielkość plazmidu: |
4.3 kb |
Origin of replication/Incompatibility group: |
pSC101 (ts)
|
Host range: |
Escherichia coli |
Inne elementy genetyczne: |
|
Właściwości szczepu/komentarz: |
Derivative of pMLO6 (pGB2ts-parS+) containing mutant P1 parS site that makes pMLO6 resistant to destabilization by ParB. |
Autor: |
Malgorzata Lobocka |
Dostępność: |
restricted |
Patent: |
|
Osoba deponująca: |
Malgorzata Lobocka |
Instytucja/wydział: |
|
Data zdeponowania: |
2006-07-02 23:10+01:00 |
Referencje: |
|