| Baza: |
Plazmidów |
| Nr w bazie: |
626 |
| Nazwa plazmidu: |
pMLO36 |
| Gatunek: |
Escherichia coli K12 |
| Szczep: |
DJ125 (=C600 recA) |
| Genotyp: |
supE44 hsdR17 thr-1 leuB6 lacY1 thi-1 tonA21 recA
|
| Sekwencja plazmidu: |
available on request |
| Konstrukcja: |
Spontaneous mutant of pMLO5 (pGB2ts-parS+)(isolated as 5/1) that is not dramatically destabilized in DJ125 lysogenized with lambda DKC296 (parA+parB+). Contains substitution of CCA between two arms of the large P1 parS palindrome by TGG (the sequence of the relevant fragment of parS in the mutant is: GTGAAATCGTGGCGATTTCACCTTGGATTTTAC)
|
| Plasmid properties/Comments: |
|
| Mapa plazmidu: |
 |
| Markery selekcyjne: |
spc, str |
| Stężenie antybiotyku: |
|
| Wielkość plazmidu: |
4.3 kb |
| Origin of replication/Incompatibility group: |
pSC101 (ts)
|
| Host range: |
Escherichia coli |
| Inne elementy genetyczne: |
|
| Właściwości szczepu/komentarz: |
Derivative of pMLO5 (pGB2ts-parS+) containing P1 parS site mutant that makes pMLO5 resistant to dramatic destabilization by ParB. This plasmid can not replicate at 42oC but can replicate at 30oC. |
| Autor: |
Malgorzata Lobocka |
| Dostępność: |
restricted |
| Patent: |
|
| Osoba deponująca: |
Malgorzata Lobocka |
| Instytucja/wydział: |
|
| Data zdeponowania: |
2006-07-02 23:10+01:00 |
| Referencje: |
|