| Base: |
Plasmid collection |
| Number in base: |
186 |
| Plasmid name: |
M01E12 |
| Species: |
E. coli |
| Strain: |
XL1-Blue |
| Genotype: |
F`::Tn10 proA+B+ lacIq Δ(lacZ)M15/recA1 endA1 gyrA96(Nalr) thi hsdR17 (rK-mK+) glnV44 relA1 lac |
| Plasmid Sequence: |
chromosomal fragment cloned into BamHI site in Bluescript II KS-, flanked by sequence 5`- GATCCTTATTTAATTTAAAAGTTTTAATTTCCTTTGGAGTATCAGGAGGA .. CTTTCCCTAAATGAATTTAAGATGAATCTAAAGAGTGCTACTATTAGATC - 3` |
| Construction: |
|
| Plasmid properties/Comments: |
|
| Plasmid map: |
 |
| Selectable Markers: |
amp |
| Antibiotic concetration: |
|
| Plasmid size: |
- |
| Origin of replication/Incompatibility group: |
|
| Host range: |
|
| Other genetic elements: |
|
| Strain properties/Comments: |
|
| Author: |
Keller AM, Cohen J |
| Availability: |
restricted |
| Patent: |
|
| Depositor: |
R. Gromadka |
| Institution/Department: |
|
| Deposition date: |
16.09.2002 |
| References: |
Trends Genet. 2001 Jun. 17(6):306-308 Dessen P. i.in.; http://paramecium.cgm.cnrs-gif.fr |