Base: |
Plasmid collection |
Number in base: |
611 |
Plasmid name: |
pAJU8 |
Species: |
Escherichia coli K12 |
Strain: |
UT5600 |
Genotype: |
leu proC trpE thiA rpsL Δ(fepA-ompT)
|
Plasmid Sequence: |
available on request |
Construction: |
Replacement of MunI-SalI fragment of pMSK4 (encoding the wild-type parB-[his]6) with MunI-SalI fragment obtained by PCR amplification of the relevant region of pMLO87mutB16 with one normal and one mutagenic primer to introduce (his)6 tag and SalI site at the end of parB16.
The nucleotide sequence between the termination codon of parB (TAA) and SalI site (GTCGAC) in this plasmid is the following: ACTTTCGCCATTCAAATTTCACTATTAACTGACTGTTTTTG
|
Plasmid properties/Comments: |
|
Plasmid map: |
 |
Selectable Markers: |
amp |
Antibiotic concetration: |
|
Plasmid size: |
~5.5 kb |
Origin of replication/Incompatibility group: |
pMB1 (pBR322)
|
Host range: |
Escherichia coli |
Other genetic elements: |
|
Strain properties/Comments: |
Derivative of pBR322 carrying transcriptional fusion of P1 parB16-(his)6 to the promoter-operator region of tryptophan operon of Serratia marcescens (trpPO). Served to overexpress mutant parB16-(his)6 for protein purification. |
Author: |
Malgorzata Lobocka |
Availability: |
restricted |
Patent: |
|
Depositor: |
Malgorzata Lobocka |
Institution/Department: |
|
Deposition date: |
2006-07-03 09:09+01:00 |
References: |
Adam Jujka (2001) Master's Thesis. IBB PAS. Warsaw; Łobocka and Yarmolinsky (1996) J. Mol. Biol. 259:366--382. |