Base: |
Plasmid collection |
Number in base: |
760 |
Plasmid name: |
pMDU10 |
Species: |
Escherichia coli K-12 |
Strain: |
DJ125 (EC15814) |
Genotype: |
F-, supE44, hsdR17, thi-1, leuB6, lacY1, tonA21, recA56
|
Plasmid Sequence: |
|
Construction: |
Replacement of BamHI - SapI fragment of pMDU3 plasmid encoding the 3' region of P1 dmt gene the equivalent fragment containing the 3' region of his-tagged dmt obtained by PCR amplification using pMDU3 DNA as a template, and primers: OMLO197 (5'GCGCAGCGGCGTTTTTGTTCC3') - OMLO305 (5'TAATAGGATCCTTAGTGGTGGTGGTGGTGGTGGAGCAATATACCCAAAACGTCATGAGCTACACC3')
|
Plasmid properties/Comments: |
|
Plasmid map: |
 |
Selectable Markers: |
amp |
Antibiotic concetration: |
|
Plasmid size: |
7070 bp |
Origin of replication/Incompatibility group: |
pMB1
|
Host range: |
E. coli |
Other genetic elements: |
|
Strain properties/Comments: |
|
Author: |
Durawa M |
Availability: |
non restricted |
Patent: |
|
Depositor: |
M. Durawa |
Institution/Department: |
|
Deposition date: |
2004-11-23 12:21+01:00 |
References: |
|