Base: |
Plasmid collection |
Number in base: |
102 |
Plasmid name: |
pET21HCVhel |
Species: |
Escherichia coli |
Strain: |
DH5α |
Genotype: |
F-, f80dlacZDM15 Dlac(lac ZYA-argF)U169, deoR, hsdR17 (rk-,mk-), recA1, endA1, gyrA46, pho A, sup E44, thi-1, relA1 |
Plasmid Sequence: |
|
Construction: |
derivative of pET21a |
Plasmid properties/Comments: |
|
Plasmid map: |
|
Selectable Markers: |
amp |
Antibiotic concetration: |
|
Plasmid size: |
6822 bp |
Origin of replication/Incompatibility group: |
|
Host range: |
E.coli |
Other genetic elements: |
|
Strain properties/Comments: |
description of the sequence in the publication contains some mistakes – the insert is cloned in pET21a, not pET21b, using a different 5` primer then described in the publication (GGGGATCCGTGGACTTTATCCCT)! |
Author: |
Kim DW, Gwack Y, Han JH, Choe J. |
Availability: |
restricted |
Patent: |
|
Depositor: |
Iwona Rosa |
Institution/Department: |
|
Deposition date: |
29.03.2002 |
References: |
Kim DW, Gwack Y, Han JH, Choe J. 1995 Biochem Biophys Res Commun 215:160-6. |