| Base: |
Plasmid collection |
| Number in base: |
102 |
| Plasmid name: |
pET21HCVhel |
| Species: |
Escherichia coli |
| Strain: |
DH5α |
| Genotype: |
F-, f80dlacZDM15 Dlac(lac ZYA-argF)U169, deoR, hsdR17 (rk-,mk-), recA1, endA1, gyrA46, pho A, sup E44, thi-1, relA1 |
| Plasmid Sequence: |
|
| Construction: |
derivative of pET21a |
| Plasmid properties/Comments: |
|
| Plasmid map: |
 |
| Selectable Markers: |
amp |
| Antibiotic concetration: |
|
| Plasmid size: |
6822 bp |
| Origin of replication/Incompatibility group: |
|
| Host range: |
E.coli |
| Other genetic elements: |
|
| Strain properties/Comments: |
description of the sequence in the publication contains some mistakes – the insert is cloned in pET21a, not pET21b, using a different 5` primer then described in the publication (GGGGATCCGTGGACTTTATCCCT)! |
| Author: |
Kim DW, Gwack Y, Han JH, Choe J. |
| Availability: |
restricted |
| Patent: |
|
| Depositor: |
Iwona Rosa |
| Institution/Department: |
|
| Deposition date: |
29.03.2002 |
| References: |
Kim DW, Gwack Y, Han JH, Choe J. 1995 Biochem Biophys Res Commun 215:160-6. |