| Base: |
Plasmid collection |
| Number in base: |
624 |
| Plasmid name: |
pMLO32 |
| Species: |
Escherichia coli K12 |
| Strain: |
DJ125 (=C600 recA) |
| Genotype: |
supE44 hsdR17 thr-1 leuB6 lacY1 thi-1 tonA21 recA
|
| Plasmid Sequence: |
available on request |
| Construction: |
Spontaneous mutant of pMLO6 (pGB2ts-parS+)(isolated as 6/1) stable in DJ125 lysogenized with lambda DKC296 (parA+parB+). Contains substitution of two T-s in the left arm of parS large palindrome by one C (the sequence of changed parS fragment is: AAAATCCAAGGTGAAAATCGCCAC)
|
| Plasmid properties/Comments: |
|
| Plasmid map: |
 |
| Selectable Markers: |
spc, str |
| Antibiotic concetration: |
|
| Plasmid size: |
4.3 kb |
| Origin of replication/Incompatibility group: |
pSC101 (ts)
|
| Host range: |
Escherichia coli |
| Other genetic elements: |
|
| Strain properties/Comments: |
Derivative of pMLO6 (pGB2ts-parS+) containing mutant P1 parS site that makes pMLO6 resistant to destabilization by ParB. |
| Author: |
Malgorzata Lobocka |
| Availability: |
restricted |
| Patent: |
|
| Depositor: |
Malgorzata Lobocka |
| Institution/Department: |
|
| Deposition date: |
2006-07-02 23:10+01:00 |
| References: |
|