| Base: |
Plasmid collection |
| Number in base: |
760 |
| Plasmid name: |
pMDU10 |
| Species: |
Escherichia coli K-12 |
| Strain: |
DJ125 (EC15814) |
| Genotype: |
F-, supE44, hsdR17, thi-1, leuB6, lacY1, tonA21, recA56
|
| Plasmid Sequence: |
|
| Construction: |
Replacement of BamHI - SapI fragment of pMDU3 plasmid encoding the 3' region of P1 dmt gene the equivalent fragment containing the 3' region of his-tagged dmt obtained by PCR amplification using pMDU3 DNA as a template, and primers: OMLO197 (5'GCGCAGCGGCGTTTTTGTTCC3') - OMLO305 (5'TAATAGGATCCTTAGTGGTGGTGGTGGTGGTGGAGCAATATACCCAAAACGTCATGAGCTACACC3')
|
| Plasmid properties/Comments: |
|
| Plasmid map: |
 |
| Selectable Markers: |
amp |
| Antibiotic concetration: |
|
| Plasmid size: |
7070 bp |
| Origin of replication/Incompatibility group: |
pMB1
|
| Host range: |
E. coli |
| Other genetic elements: |
|
| Strain properties/Comments: |
|
| Author: |
Durawa M |
| Availability: |
non restricted |
| Patent: |
|
| Depositor: |
M. Durawa |
| Institution/Department: |
|
| Deposition date: |
2004-11-23 12:21+01:00 |
| References: |
|